 |
 |
|
 |
|
|
|
|
|
|
|
|
||||||||||||||
|
How is the DNA Organized Into Chromosomes?
The DNA in each of your cells contains 3 billion (3,000,000,000) of these base pairs. To get a sense of how big that number is, imagine we are going to type out your genetic code in the four letters, A, T, G, and C. We can get about 1500 letters on each page. After writing out 400 of these pages, we'll bind those pages in a book. It will take 5,000 books to complete the sequence of bases present in your DNA. The following is a short section of the DNA that codes for FMRP (fragile X mental retardation protein). GACTTACGGCAAATGTGTGCCAAAGAGGCGGCACATAAG
Those 3 billion base pairs make up 6 feet of DNA and are organized into 46 chromosomes or 23 pairs of chromosomes. You receive 23 chromosomes from each of your parents. Each set of 23 chromosomes contains a complete set (with one exception noted below) of instructions (genes) for how to assemble a human. Thus you get a pair of each of your genes. You characteristics depend on the interaction of those pairs of genes. Twenty-two of the pairs of chromosomes are similar in males and females. These are called autosomes. The 23rd pair is different. A female has two X chromosomes and a male has an X and a Y chromosome. Because they are different in males and females, we call the X and Y, sex chromosomes.
Copyright by Hironao NUMABE, M.D. Tokyo Medical University The Y chromosome triggers the development of male characteristics. It has virtually no information beyond what is required to set maleness in motion. Other than that, the Y chromosome is a blank. The X chromosome has almost nothing to do with femaleness. Instead, it has genes with information for all sorts of characteristics need by both males and females. For example, a gene that is important in the functioning of the brain, the gene that causes fragile X syndrome, is located on the X chromosome. It might seem that since females have two X chromosomes, they would make too much of the proteins coded for on those chromosomes or males might not make enough. Females compensate for this difference by turning off one of their X chromosomes in each of their cells by a process called methylation. This methylation plays a role in determining the impact of fragile X on females. Fragile X syndrome itself involves methylation that turns off the FMR1 gene.
When a female produces eggs, she divides up her pairs of chromosomes also. All her eggs get an X chromosome. Each egg and sperm will get a number 1 chromosome, a number 2 chromosome, etc. However, the process of selecting which number 1 chromosome is used is random. Thus, each egg or sperm you produce has a different combination of the chromosomes you received from your mother and father.
|
|||||||||||||||||||
 |
|||||||||||||||||||
 |
|||||||||||||||||||
|
© copyright 1998-2008 NFXF |
|||||||||||||||||||
Most of the pages in your 5,000 book library are similar or identical to the pages
of another human. In other words, the majority of your DNA is identical to that of other humans. A small percentage is different and that is what makes you
unique. Some of those differences give us our particular hair color, finger length, ear shape, and rate of metabolism. Other variations can lead to inherited diseases.
 |
|
|
|